ID: 1199045565_1199045569

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1199045565 1199045569
Species Human (GRCh38) Human (GRCh38)
Location X:143167294-143167316 X:143167319-143167341
Sequence CCTGTGTGGTGTCTTCTGAGTGA CTGAAGAAGCAGAAGGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 191} {0: 1, 1: 0, 2: 8, 3: 84, 4: 861}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!