ID: 1199094759_1199094766

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1199094759 1199094766
Species Human (GRCh38) Human (GRCh38)
Location X:143726158-143726180 X:143726178-143726200
Sequence CCCCGCTGGCTTCACCTAGTGGA GGATCCCACGCTAGGGCCGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 22, 3: 48, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!