ID: 1199110539_1199110553

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1199110539 1199110553
Species Human (GRCh38) Human (GRCh38)
Location X:143928792-143928814 X:143928843-143928865
Sequence CCGGGCGTGGTGGTGGGCACCTG AGGAGAATGGTGTGGAACCCGGG
Strand - +
Off-target summary {0: 2607, 1: 15321, 2: 42780, 3: 74393, 4: 93183} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!