ID: 1199110544_1199110555

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1199110544 1199110555
Species Human (GRCh38) Human (GRCh38)
Location X:143928819-143928841 X:143928849-143928871
Sequence CCCAGCTACCCGGGAGGCTGAGG ATGGTGTGGAACCCGGGAGGCGG
Strand - +
Off-target summary {0: 1384, 1: 109035, 2: 293638, 3: 223658, 4: 121871} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!