ID: 1199110548_1199110553

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1199110548 1199110553
Species Human (GRCh38) Human (GRCh38)
Location X:143928827-143928849 X:143928843-143928865
Sequence CCCGGGAGGCTGAGGCAGGAGAA AGGAGAATGGTGTGGAACCCGGG
Strand - +
Off-target summary {0: 3953, 1: 5516, 2: 4741, 3: 4253, 4: 6042} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!