ID: 1199124485_1199124490

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1199124485 1199124490
Species Human (GRCh38) Human (GRCh38)
Location X:144099614-144099636 X:144099650-144099672
Sequence CCAGTCCCAAGGCTACAGTAGTT CTGTGTGACCAGATGGTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 95} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!