ID: 1199137039_1199137048

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1199137039 1199137048
Species Human (GRCh38) Human (GRCh38)
Location X:144265905-144265927 X:144265932-144265954
Sequence CCCATAGCCATCCCCCATATCAC CTGGCATGTGAATGTGTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!