ID: 1199144440_1199144445

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1199144440 1199144445
Species Human (GRCh38) Human (GRCh38)
Location X:144348958-144348980 X:144348997-144349019
Sequence CCCAGTAACAGGCCAAGAGCTGT AGGTATCTGAAGAAGATAGCAGG
Strand - +
Off-target summary {0: 174, 1: 194, 2: 145, 3: 123, 4: 215} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!