ID: 1199182830_1199182832

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1199182830 1199182832
Species Human (GRCh38) Human (GRCh38)
Location X:144878666-144878688 X:144878699-144878721
Sequence CCTTTTTTTTTTTTTTTAACATA TCTGCTTCTCCTCACTATGCAGG
Strand - +
Off-target summary {0: 6, 1: 99, 2: 843, 3: 5188, 4: 18747} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!