ID: 1199193832_1199193840

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1199193832 1199193840
Species Human (GRCh38) Human (GRCh38)
Location X:145003692-145003714 X:145003745-145003767
Sequence CCTTCAAGGGTTTTGAGTCATTA CTGAAGATGGAGAAGGAGGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 13, 3: 147, 4: 1265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!