ID: 1199213759_1199213762

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1199213759 1199213762
Species Human (GRCh38) Human (GRCh38)
Location X:145244167-145244189 X:145244191-145244213
Sequence CCTGGCTGTGGCTTCCTGTGAGC GATCTATTAGGCAGTAGTTGAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 3, 3: 37, 4: 296} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!