ID: 1199215892_1199215897

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1199215892 1199215897
Species Human (GRCh38) Human (GRCh38)
Location X:145259971-145259993 X:145260001-145260023
Sequence CCCTCCTTCCTATGCATTTCACA CTCCTAAATCACTGCCTTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 322} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!