ID: 1199239601_1199239605

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1199239601 1199239605
Species Human (GRCh38) Human (GRCh38)
Location X:145530696-145530718 X:145530710-145530732
Sequence CCTCCAATTTGATCCCTGGTAAA CCTGGTAAAGAATTAATATGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!