ID: 1199264195_1199264196

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1199264195 1199264196
Species Human (GRCh38) Human (GRCh38)
Location X:145811122-145811144 X:145811157-145811179
Sequence CCAAAATAATCATCAGCATTTTG TCTTAAACATTACATTACTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 25, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!