ID: 1199271294_1199271309

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1199271294 1199271309
Species Human (GRCh38) Human (GRCh38)
Location X:145885600-145885622 X:145885644-145885666
Sequence CCCACCCCCTGCTCCTGTTACGG ATGGCCAAATGTTGTGGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!