ID: 1199325109_1199325115

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1199325109 1199325115
Species Human (GRCh38) Human (GRCh38)
Location X:146490072-146490094 X:146490115-146490137
Sequence CCCATCCTAGTGGTCAGAACTTG CACCGCACACTGAAGTGCTCTGG
Strand - +
Off-target summary {0: 2, 1: 35, 2: 79, 3: 163, 4: 362} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!