ID: 1199392611_1199392615

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1199392611 1199392615
Species Human (GRCh38) Human (GRCh38)
Location X:147298325-147298347 X:147298374-147298396
Sequence CCAGCCTGGACAACATGGTAAAA ACACAAAAAAGCAAAAAATTAGG
Strand - +
Off-target summary {0: 213, 1: 10515, 2: 136979, 3: 199297, 4: 200095} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!