ID: 1199392612_1199392615

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1199392612 1199392615
Species Human (GRCh38) Human (GRCh38)
Location X:147298329-147298351 X:147298374-147298396
Sequence CCTGGACAACATGGTAAAATCCC ACACAAAAAAGCAAAAAATTAGG
Strand - +
Off-target summary {0: 11, 1: 632, 2: 13286, 3: 113470, 4: 203466} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!