ID: 1199393159_1199393177

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1199393159 1199393177
Species Human (GRCh38) Human (GRCh38)
Location X:147305690-147305712 X:147305732-147305754
Sequence CCACCCCTCCCCCATCCCCCAGC AAGGACAGTGCAGTGACTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 26, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!