ID: 1199446268_1199446270

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1199446268 1199446270
Species Human (GRCh38) Human (GRCh38)
Location X:147926077-147926099 X:147926102-147926124
Sequence CCTACAAGCTTTAGTTTATACAT TGGTAAAATCTCTTTTTCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 25, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!