ID: 1199464444_1199464453

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1199464444 1199464453
Species Human (GRCh38) Human (GRCh38)
Location X:148120264-148120286 X:148120315-148120337
Sequence CCCTATCCTCAGGCAGGGCAGTG AGGGAGAGCAAAGTGATTGTGGG
Strand - +
Off-target summary No data {0: 7, 1: 38, 2: 80, 3: 167, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!