ID: 1199574105_1199574110

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1199574105 1199574110
Species Human (GRCh38) Human (GRCh38)
Location X:149296902-149296924 X:149296915-149296937
Sequence CCTTAAGCAAGGCCCTTCCTCTC CCTTCCTCTCTGGGCCTCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 74, 4: 566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!