ID: 1199578838_1199578846

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1199578838 1199578846
Species Human (GRCh38) Human (GRCh38)
Location X:149341383-149341405 X:149341435-149341457
Sequence CCTGCTTGTATCAGCTGTGTCTG CATAGTGCCTGCACAGTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!