ID: 1199601609_1199601612

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1199601609 1199601612
Species Human (GRCh38) Human (GRCh38)
Location X:149544500-149544522 X:149544517-149544539
Sequence CCACTATTTCTGACTGTTCTATT TCTATTAGGTGCCACGTACTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 346} {0: 1, 1: 1, 2: 3, 3: 18, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!