ID: 1199605086_1199605092

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1199605086 1199605092
Species Human (GRCh38) Human (GRCh38)
Location X:149571337-149571359 X:149571382-149571404
Sequence CCTCTTTATGCTAGGAAGCCAAA TCTGCTGCACCTATAGATTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 184} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!