ID: 1199606765_1199606780

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1199606765 1199606780
Species Human (GRCh38) Human (GRCh38)
Location X:149584781-149584803 X:149584826-149584848
Sequence CCCCCCCGCCCCCAGATCTAAGA GGGGTGGCTTCTTTCTGCGTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 33, 4: 283} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!