ID: 1199608098_1199608108

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1199608098 1199608108
Species Human (GRCh38) Human (GRCh38)
Location X:149592714-149592736 X:149592760-149592782
Sequence CCATGGAGGCAGCAGGCTGTGCA CGGTACCCAGAGATGGCAAAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 39, 4: 331} {0: 2, 1: 0, 2: 0, 3: 12, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!