ID: 1199613874_1199613879

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1199613874 1199613879
Species Human (GRCh38) Human (GRCh38)
Location X:149639930-149639952 X:149639946-149639968
Sequence CCTAGCTGCTCCAGCCCTGCAGT CTGCAGTCCTTAGGAAACACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 42, 4: 359} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!