ID: 1199630965_1199630973

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1199630965 1199630973
Species Human (GRCh38) Human (GRCh38)
Location X:149776394-149776416 X:149776424-149776446
Sequence CCAGCCGGCCGGCGAGTGGTCAG CCAGGCTCACGTCACTCCGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 61} {0: 2, 1: 0, 2: 0, 3: 4, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!