ID: 1199679263_1199679268

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1199679263 1199679268
Species Human (GRCh38) Human (GRCh38)
Location X:150214291-150214313 X:150214311-150214333
Sequence CCTTCAGGCATCTCCTCACTGGT GGTCTCCAGGTGGGCCTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 259} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!