ID: 1199692341_1199692344

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1199692341 1199692344
Species Human (GRCh38) Human (GRCh38)
Location X:150318152-150318174 X:150318178-150318200
Sequence CCTCTGCTTGGAAGCCATTCTTC TTGTCCCCCTGGAAGACTAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!