ID: 1199734866_1199734872

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1199734866 1199734872
Species Human (GRCh38) Human (GRCh38)
Location X:150676402-150676424 X:150676425-150676447
Sequence CCTGCAAGGATAGAGACAGATGG TGGACTTCTGGGCCAGTATAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!