ID: 1199746657_1199746670

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1199746657 1199746670
Species Human (GRCh38) Human (GRCh38)
Location X:150776039-150776061 X:150776068-150776090
Sequence CCACCCCCGTCCCAGGAAGTCTG AGTGGGTCTCAGGCAGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 280} {0: 1, 1: 0, 2: 3, 3: 52, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!