ID: 1199751994_1199751996

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1199751994 1199751996
Species Human (GRCh38) Human (GRCh38)
Location X:150828635-150828657 X:150828651-150828673
Sequence CCAGTAAATATATGATGCTCCAT GCTCCATTTGACTACAATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 126} {0: 1, 1: 0, 2: 0, 3: 8, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!