ID: 1199771133_1199771136 |
View in Genome Browser |
Spacer: -8 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1199771133 | 1199771136 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | X:150976051-150976073 | X:150976066-150976088 |
Sequence | CCGCTTTTCATTCAATATGAAAG | TATGAAAGGAACCCAGAGCAGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 0, 2: 1, 3: 32, 4: 363} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |