ID: 1199786732_1199786739

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1199786732 1199786739
Species Human (GRCh38) Human (GRCh38)
Location X:151112676-151112698 X:151112719-151112741
Sequence CCTGCCAGCTCAAGTGTCTGTGC GCCAGGATTCCAGAAGTCCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 24, 3: 75, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!