ID: 1199793388_1199793406

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1199793388 1199793406
Species Human (GRCh38) Human (GRCh38)
Location X:151175362-151175384 X:151175415-151175437
Sequence CCGCAGGGGAACTGTGACGCACG GGGGGAGGCCTGAGAGGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 43, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!