ID: 1199818082_1199818084

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1199818082 1199818084
Species Human (GRCh38) Human (GRCh38)
Location X:151418039-151418061 X:151418068-151418090
Sequence CCAGAGTTGGTAGAAACAAAATC GTGTGATTAGAATGGATCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 216} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!