ID: 1199850715_1199850730

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1199850715 1199850730
Species Human (GRCh38) Human (GRCh38)
Location X:151723368-151723390 X:151723418-151723440
Sequence CCCAGCCCCAGCTTTGCAAAGTT GCTTGTGGGGGTGTGGTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!