ID: 1199851827_1199851836

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1199851827 1199851836
Species Human (GRCh38) Human (GRCh38)
Location X:151729309-151729331 X:151729348-151729370
Sequence CCCAGCCCCATCTTTGTCTATAA TTGGCAAAGCAGCCCAATCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!