ID: 1199853878_1199853883

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1199853878 1199853883
Species Human (GRCh38) Human (GRCh38)
Location X:151744193-151744215 X:151744206-151744228
Sequence CCTGATGCCAAGAAAGTCCTAGA AAGTCCTAGAAGAGAGGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 204} {0: 1, 1: 0, 2: 3, 3: 16, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!