ID: 1199893290_1199893299

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1199893290 1199893299
Species Human (GRCh38) Human (GRCh38)
Location X:152109521-152109543 X:152109557-152109579
Sequence CCATCTAACCTTCCCATGTCCAG CCTCTACCCTAGACAGTGTATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 5, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!