ID: 1199900309_1199900315

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1199900309 1199900315
Species Human (GRCh38) Human (GRCh38)
Location X:152166375-152166397 X:152166422-152166444
Sequence CCCATATCCCCACATATCCACAA TTACCTACAGACACAGTCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 277} {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!