ID: 1199905514_1199905515

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1199905514 1199905515
Species Human (GRCh38) Human (GRCh38)
Location X:152225290-152225312 X:152225315-152225337
Sequence CCTGATCATTAACAGACAGACAA AACATAATTCTGCTGCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 155} {0: 1, 1: 0, 2: 0, 3: 16, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!