|
Left Crispr |
Right Crispr |
Crispr ID |
1199911289 |
1199911291 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
X:152289710-152289732
|
X:152289742-152289764
|
Sequence |
CCTGTGTCCAGGTGCTTTCACTG |
CACCTATGAGTGAGAACATGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 1, 2: 82, 3: 2225, 4: 26341} |
{0: 8120, 1: 14274, 2: 8213, 3: 6298, 4: 4752} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|