ID: 1199947322_1199947337

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1199947322 1199947337
Species Human (GRCh38) Human (GRCh38)
Location X:152679849-152679871 X:152679900-152679922
Sequence CCCGTTGCAACCCAAGATAGAGG TGCCAACCCAGGACCACCCGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!