ID: 1199947332_1199947344 |
View in Genome Browser |
Spacer: -2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1199947332 | 1199947344 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:152679893-152679915 | X:152679914-152679936 |
| Sequence | CCCCTGCTGCCAACCCAGGACCA | CACCCGGGGGCGGACTTCTCAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 2, 1: 1, 2: 5, 3: 5, 4: 47} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||