ID: 1199947334_1199947344

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1199947334 1199947344
Species Human (GRCh38) Human (GRCh38)
Location X:152679895-152679917 X:152679914-152679936
Sequence CCTGCTGCCAACCCAGGACCACC CACCCGGGGGCGGACTTCTCAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 5, 3: 5, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!