ID: 1199947806_1199947814

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1199947806 1199947814
Species Human (GRCh38) Human (GRCh38)
Location X:152681844-152681866 X:152681891-152681913
Sequence CCTTGCCCCTGCTGTTTCCGCAG GAGGCCCCCTCTCTTATACCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 50, 4: 329} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!