ID: 1199952778_1199952785

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1199952778 1199952785
Species Human (GRCh38) Human (GRCh38)
Location X:152718654-152718676 X:152718699-152718721
Sequence CCCTGGTAGTAGTGGGGATTCTA CCCATAGGGTCATAGAGTCTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 97} {0: 2, 1: 1, 2: 3, 3: 5, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!